 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circ_STK24 | |||
| Gene | STK24 | Organism | Human |
| Genome Locus | chr13:99157169-99171727:n/a | Build | hg19 |
| Disease | Temporal Lobe Epilepsy | ICD-10 | Malignant neoplasm of Long bones of lower limb (C40.2) |
| DBLink | Link to database | PMID | 29428937 |
| Experimental Method | |||
| Sample Type | Brain Tissues | Comparison | Temporal cortices were collected from 17 Temporal Lobe Epilepsy (TLE) patients and 17 non-TLE patients |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGCCTTTAGGTTCTTCAGAT ReverseCAATCGGACTCAGAAAGTG | Statistics | Fold Change : Upregulated,4.18 pvalue : p<0.05 |
| Citation | |||
| Li, J, Lin, H, Sun, Z, Kong, G, Yan, X, Wang, Y, Wang, X, Wen, Y, Liu, X, Zheng, H, Jia, M, Shi, Z, Xu, R, Yang, S, Yuan, F (2018). High-Throughput Data of Circular RNA Profiles in Human Temporal Cortex Tissue Reveals Novel Insights into Temporal Lobe Epilepsy. Cell. Physiol. Biochem., 45, 2:677-691. | |||